guidelines for authors

Guidelines for the RNA Families Track

This track will primarily publish articles describing either: (1) substantial updates and reviews of existing RNA families or (2) novel RNA families based on computational and/or experimental results for which little evolutionary analysis has been published. These articles must be accompanied by STOCKHOLM formatted alignments, including a consensus secondary structure or structures and a corresponding Wikipedia article. Publication in the track will require a short manuscript, a high quality Stockholm alignment and at least one Wikipedia article; Each centered around the RNA in question.

Writing the manuscript:

The article itself should adhere to the format: Abstract, Introduction, Results, Discussion, Materials and Methods and Supplementary Material.
The Introduction should give an overview of the family detailing how and when were the original members identified, what is the function (if known) of the family and what was previously known about the taxonomic distribution of the family.
The Results section should discuss the new homologues (distinguishing paralogues and orthologues) found in the study, discuss the taxonomic distribution and evolutionary conservation of the families sequence and structure. Suggested figures are secondary structure diagrams, alignments (of the smaller families), phylogenetic trees and sequence logos.
The Conclusions/Discussion section should not repeat in detail data given in the Results section. Emphasize the new and important aspects of the study. Relate observations to other relevant studies. On the basis of your findings (and others’), discuss possible implications/conclusions.
The Materials and Methods section should detail: the sources of seed sequences and structures; the methods and tools used for homology searches, alignments and secondary structure predictions; the sequence databases searched. Correct version numbers and references should be given where relevant.

To be eligible for publication the Supplementary Material must contain:
(1) a link to a Wikipedia article preferably in a User's space. Upon acceptance this can easily be moved into Wikipedia itself together with a reference to the published article.
(2) a plain text Stockholm formatted file containing an alignment and consensus secondary structure for the family.

Formatting your Stockholm alignment:

The quality and consistency of the submitted alignment will be of primary importance for publication in the RNA families track.

The minimal requirements for a Stockholm alignment are:
(1) A header line eg. '# STOCKHOLM 1.0'.
(2) At least two sequences, each preceded with a unique plain-text sequence ID.
(3) A secondary structure line, preceded with the tag '#=GC SS_cons ', followed by a secondary structure string. Consensus basepairs are represented by matching parentheses, any of '({[<>]})' type parentheses are acceptable. Unpaired sites can be indicated by any of the characters '.,;'. Pseudoknots should be marked-up by matching upper and lower case english alphabet characters. The 5' nucleotide within the knot should be in uppercase and the 3' nucleotide lowercase.
(4) A footer line indicating the end of alignment eg. '// '.

Ideally the alignment will be marked up with information distinguishing between experimentally validated seed sequences and computationally determined homologs. The sources and relevant identifiers of each sequence can also be documented. These additional pieces of information can be added using '#=GS <seq_id> <tag> <free-text>' tags. 

See the Infernal userguide and/or http://en.wikipedia.org/wiki/Stockholm_format for more information. Also, there are a few handy tools for dealing with Stockholm alignments:
-sreformat is useful for converting between different formats.
-Ralee is a handy alignment editor that supports (RNA) Stockholm format.
-Infernal and HMMer both accept Stockholm formats for homology search and alignment.

# STOCKHOLM 1.0
#=GF WK http://en.wikipedia.org/wiki/UPSK_RNA
#=GS tym_vir1 CC EMBL_ID: AF035635.1/619-641 Turnip yellow mosaic virus unpublished
#=GS tym_vir2 CC EMBL_ID: M24804.1/82-104 Turnip yellow mosaic virus unpublished
#=GS tym_vir3 CC EMBL_ID: J04373.1/6212-6234 Turnip yellow mosaic virus published # REF: Virology. 2004 Mar 30;321(1):36-46.
#=GS tym_vir4 CC EMBL_ID: M24803.1/1-23 Turnip yellow mosaic virus unpublished
tym_vir1 UGAGUUCUCGAUCUCUAAAAUCG
tym_vir2 UGAGUUCUCUAUCUCUAAAAUCG
tym_vir3 UAAGUUCUCGAUCUUUAAAAUCG
tym_vir4 UAAGUUCUCGAUCUCUAAAAUCG
#=GC SS_cons .AAA....<<<<aaa....>>>>
//

A short guide to creating your first Wikipedia article:

At least one stub article (essentially an extended abstract) for the paper should be added to either an author's userspace at Wikipedia (preferred route) or added directly to the main Wikipedia space (be sure to add literature references to avoid speedy deletion). This article will be reviewed alongside the manuscript and may require revision before acceptance. Upon acceptance the former articles can easily be exported to the main Wikipedia space. See below for guidelines on how to do this. Existing articles can be updated in accordance with the latest published results.

1. Create an account for yourself at Wikipedia. Go to your favorite Wikipedia article e.g. http://en.wikipedia.org/wiki/RNA and click on the "Log in / create account" link at the top of the page; Follow the instructions for creating an account for yourself.

2. Once you have logged in you can go to your userpage by clicking on your username at the top of the page (Paul Gardner's for example takes him to the URL http://en.wikipedia.org/wiki/User:Ppgardne). You can personalize this page as you like. To create your stub article, simply add "/name_of_RNA_family" to the URL. For example, if one wanted to create an article about the new eRNA family one would visit the URL "http://en.wikipedia.org/wiki/User:Ppgardne/eRNA." Click on the option "Start the User:Ppgardne/eRNA page" and then add the content that you would like to appear in the article to the text box. You can view previews of the article as you work, do not forget to push save once you are happy with the article.

  • An excellent option for inexperienced users is to write a draft of the article using OpenOffice (version 2.3 or greater). OpenOffice can export content directly in WikiMedia format!
  • Keep in mind that Wikipedia articles are to be targeted at a level that an undergraduate could comprehend. Try to avoid jargon and do provide links to other Wikipedia articles at the first use of specific terms, e.g. [[RNA]]. Also the title of the page should appear in bold at the first use of the text of the article, e.g. "eRNA."

3. References can be generated in Wikipedia format using the template filler tool.
Add these at end of relevant sentences within the text after punctuation points.

4. To get a nicely formatted reference list at the bottom of the page just add the following two lines:
==References==
{{reflist|2}}

For more help see: http://en.wikipedia.org/wiki/Help:Starting_a_new_page
Take note to ensure that any uploaded figures conform to Wikipedia's image use policy
An example of a good RNA page is the hammerhead ribozyme article.

Editorial Policy

It is the special policy of RNA Biology to guarantee a decision to accept a manuscript for publication within five business days from the date of receipt manuscripts that have been previously submitted to journals with an impact factor of 10 or higher (including all Cell journals, all Nature journals, Science, PNAS, EMBO Journal, Plant Cell, and New England Journal of Medicine) that have undergone peer review and for which the complete reviewers' comments are made available to RNA Biology.

Click here for more information.

Peer Review

Click here for more information.

Open Access Policy

Landes Bioscience recognizes that some authors prefer that their research be freely available to all potential readers upon publication, and that certain funding agencies including, but not limited to, Howard Hughes Medical Institute, MRC, NIH, and The Wellcome Trust, require open access of agency-funded research within six months to one year of publication.

To address these requirements, we provide the following options for our authors:
(1) One year after publication. ALL papers will become open access to ALL users throughout the world after having been published online for one year. Authors may deposit a PDF of the final manuscript with PubMed Central or UK PubMed Central once the paper has been made freely availble at the journal's website.
(2) Immediately upon publication. Authors may purchase open access of their paper at the proof stage and the paper will be made freely available at our website. Again, if the paper is funded by a NIH, MRC or Wellcome Trust grant, authors may deposit a PDF of the final manuscript with PubMed Central or UK PubMed Central. The fee for open access is $750.

NIH Manuscript Submission System for PubMed Central

UK PubMed Central Manuscript Submission System

Manuscript Submission

Pre-Submission Inquiries

Pre-submission inquiries are encoruaged. These may include either an abstract or a full length manuscript as an email attachment (Microsoft Word). Pre-submission inquiries should be emailed to the Editor-in-Chief, Renee Schroeder.

Electronic Submission

All papers should be accompanied by a cover letter to the Editor-in-Chief that briefly outlines the content of the manuscript. The author should also affirm that all contributing Authors know of and concur with the submission of this manuscript. Authors are also responsible for recognizing and disclosing any conflict of interest that could be perceived to bias their work, acknowledging all financial support and any other personal connections.

We now utilize an online submission and tracking system which is designed to provide a better, more efficient service to authors.

- Authors can submit manuscripts online from anywhere in the world.
- Authors can track their manuscript through the peer review process.
- Author files are automatically converted into a PDF (Portable Document Format) file and submissions are acknowledged by email.
- Editors and reviewers access the PDF files on the website.

Please read the directions below and then click here to submit a manuscript to RNA Biology: http://rnabiol.msubmit.net/

All submissions must be accompanied by a completed copyright transfer form.
Fax to Kristen Moore at 512.637.6079

Non-Native Speakers of English

Authors who are not native speakers of English and submit manuscripts to international journals often receive negative comments from referees or editors about English-language usage. These problems can contribute to a decision to reject a paper. To help reduce the possibility of such problems, we strongly encourage such authors to take at least one or both of the following steps.

1. Have your manuscript reviewed for clarity by a colleague whose native language is English.

2. Use a service such as one of those listed below. An editor will improve the English to ensure that your meaning is clear and identify problems that require your review. Note that the use of such a service is at the author's own expense and risk and does not guarantee that the article will be accepted. Landes Bioscience accepts no responsibility for the interaction between the author and the service provider or for the quality of the work performed.

American Journal Experts

American Journal Experts (AJE) provides professional language editing services to authors around the globe who wish to publish in scientific, technical, medical and humanities journals. AJE employs expert editors with post-graduate training in a wide variety of fields who will check your manuscripts not only for terminology and language specific to your field but also for proper English usage, grammar, punctuation, spelling, verb tense, and phrasing. In addition, AJE's professional editors will make sure the text sounds natural and the sentences are well constructed.

Receive a 10% discount: enter code 'Landes' into your account to receive your discount.

Bioedit English Language Editing

Bioedit Ltd, an online English editing company, offers unprecedented, high-quality English editing of biomedical texts destined for submission to peer-reviewed journals in the life sciences. The texts are edited by a large, expert team of native English-speaking editors with PhDs and years of experience in a broad range of disciplines in medicine and biology.

  • Editing of the same manuscript by up to three independent editors, including a subject-specific editor and a grammar expert.

  • Tremendous value with no hidden costs.

  • Express editing in less than 48 hours.

  • Secure and confidential.

First-time clients will receive a special 20% rebate if they are submitting their work to a Landes Bioscience journal.

Global BioEditing

Global BioEditing is a specialist service for the editing of English in biological documents. Our editing will not only make your manuscripts appear as though written by a native speaker of English but will also clarify your writing.

Inter-Biotec

Inter-Biotec also provides a free online writing course to help biomedical scientists whose first language is not English to write and publish their papers in English-language journals.

SPI Professional Editing Services

Write Science Right

Manuscript Preparation

Click here for more information.

Text should be prepared in MS Word, double-spaced, with page numbers throughout. Papers should be written as concisely as possible in clear, grammatical English and organized in the following manner:

1. Title page, including titles, author's names, email addresses, degrees and affilitations
2. 5-10 key words (for indexing purposes)
3. a list of abbreviations and acronyms used throughout the text
4. an abstract (150-250 words; depends upon type of paper, see below)
5. a running title of no more than 50 characters in length
6. Text (length depends upon type of paper, see below).
7. References
8. Tables (with descriptive titles and legends)
9. Figure legends

The citation of your article will be sent to PubMed within one week of acceptance so please ensure all information is correct.

Types of Papers

Research Papers should include the following sections:

  1. Abstract: A single paragraph of fewer than 250 words. The primary goal of the abstract should be to make the general significance and conceptual advance of the work clearly accessible to a broad readership. References should not be cited in the abstract.
  2. Introduction
  3. Results: Present results in logical sequence in tables and illustrations. In the text, explain, emphasize or summarize the most important observations. Units of measurement should be expressed in accordance with Systeme International d’Unites (SI Units).
  4. Discussion: Do not repeat in detail data given in the Results section. Emphasize the new and important aspects of the study. Relate observations to other relevant studies. On the basis of your findings (and others’), discuss possible implications/conclusions. When stating a new hypothesis, clearly label it as such.
  5. Patients and Methods/Materials and Methods: Describe selection of patients or experimental animals, including controls. Do not use patients’ names or hospital numbers. Identify methods, apparatus (manufacturer’s name and address), and procedures in sufficient detail to allow other workers to reproduce the results. Provide references and brief descriptions of methods that have been published. When using new methods. Evaluate their advantages and limitations. Identify drugs and chemicals, including generic name, dosage, and route(s) of administration.
  6. References. No more than 85. Click here to view our reference format.
  7. Tables: Tables should be numbered consecutively with Arabic numerals and include descriptive titles and legends.
  8. Figure legends

Technical Papers contain original research, however, they differ from Research Papers in that they describe new approaches, methods, or reagents rather than new understanding of a natural molecule or biological process. Papers may be submitted as either Technical or Research Papers, but the assignment to either category is the discretion of the Editors. All submissions will be peer reviewed.

Reviews should be recognized as scholarly by specialists in the field being covered, but should also be written with a view to informing readers who are not specialized in that particular field, and should therefore be presented using simple prose. Please avoid excessive jargon and technical detail. Reviews should capture the broad developments and implications of recent work. The opening paragraph should make clear the general thrust of the reveiw and provide a clear sense of why ther eview is now particularly appropriate. The conclusing paragraph shoud provide the reader with an idea of how the field may develop or future problems to be overcome, but should not summarize the article.
To ensure that a review is likely to be accessible to as many readers as possible, it may be useful to ask a colleague from antoerh disciplien to read the reveiw before submitting it.
Submitted reviews are subject to the same page charges as full length reportsÑwhether and how page charges will apply for commissioned reviews will be made clear when each review is commissioned. Reviews should include an abstract of 150 words and should cite no more than 150 references.

Point of View articles should follow the same general guidelines as reviews, however there is considerable flexibility in the length and content. These articles are intended to address controversial issues, express new ideas, or expand on work already published. They may contain new data, and like other submissions, are subject to peer review. Like review articles, they should be accessible to a wide readership. Point of View articles are generally commissioned from authors of the most important recent papers to offer additional insights. Unsolicited Point of View articles are also welcome, and these may discuss the authors' own work or recent significant work in their field. These should be structured like reviews and be 1500 to 2500 words. Responses to Point of View articles are encouraged and will also be published as Point of View articles. Responses may be considerably shorter and structured as letters. Please include an abstract of 150 words.

Addenda are essentially an auto-commentary. The Editorial Board will solicit authors of the most significant recent and forthcoming papers, published elsewhere, to provide a short summary with additional insights, new interpretations or speculation on the relevant topic. These manuscripts may include data or models, which due to space limitations were not included or discussed in the original paper. In other words, the authors may provide biased and uncensored points of views, complementing their article. As with other papers published in RNA Biology, addenda will appear on-line, in print and eventually on MedLine/PubMed. Addenda will appear simultaneously, or very soon after, publication of the original paper.

Please include an abstract of 150-200 words and 5-10 key words for indexing purposes. The typical length of an addendum will be approximately 500-1,000 words and may include up to 30 references. There will be no page charges for addenda and you are encouraged to include figures; however, please note the journal policy regarding color charges below.

Meeting Reports. Authors are encouraged to contact the journal (Email Dr. Schroeder) with proposals for meeting reports. Please contact the meeting organizers to verify that reports will be permitted.

Text Files and Tables

Please save text and table files as Microsoft Word documents. Save tables in a file separate from text. Figure legends, however, should be at the end of the manuscript as text. Tables will be reformatted during production and therefore should only be minimally formatted in your text file.

Figures (Illustrations)

Click here for guidelines on figure preparation and the required formats.

References

Click here to view our reference format. References for review articles are limited to 150. For Research Papers, please limit references to 85. For Addenda, and Commentaries and Views, please limit references to 30.

The reference format for RNA Biology is the same as that for Cell Cycle. Click here to download this output style from EndNotes.

Supplementary Files

Click here for more information.

Page and Color Charges

For original research papers that occupy more than four pages of the journal, publication of the first four monochrome pages is free but papers are published on the understanding that the author will pay a charge of $80 U.S. dollars for each additional page or part-page used.

Publication of color images is free for the online version of the journal, but carries a page charge of $340 US dollars for the initial page and $150 for each additional page in the print edition. If you prefer that color figures appear online only and in black and white for the print version, please make sure that the figure legends for each version of the figure are provided.

For guidance, a four page article with 3 figures (approx 9cmx9cm, =3.5" x 3.5") and 100 references would consist of approximately 3200 words of text including figure legends.

Under exceptional circumstances, where there are no funds to cover page charges and articles cannot be reduced in size, authors may appeal directly to the Editor for page charges to be waived. This appeal must be supported by a letter signed by finance official at the author’s institution, confirming that no funds are available to cover page charges.

Page Proofs

Page proofs should be returned within two working days, preferably by email or fax. Corrections should be marked on the actual proof and provided in a numbered list. Lengthy additions should be avoided, but where necessary should be provided in a MS Word file with explicit instructions regarding placement.

Reprints

A reprint order form will be sent to the author prior to the issue going to press or you may download it here.

Cover Image Submissions

RNA Biology publishes cover illustrations that are taken from articles in each issue, or that are designed to accompany an accepted article.

The cover illustration should be scientifically interesting and visually attractive. The illustration need not be a figure from the paper but should be closely related to the subject of the paper. If you are interested in submitting a figure for use as the cover of RNA Biology please email a high-resolution version of your image, conforming to the specifications below, and an explanatory caption of 50-60 words to Kathryn Sauceda.

RNA Biology Cover Image Specifications: All potential cover images should be sized to fill the entire cover. 12'' high and 9'' wide should be the minimum size. Larger files are even better. Please remove all text, captions, etc. from the image. If you have variations of the image you may send additional files. Please send no more than 2 alternate versions.

Accepted formats and resolution:

  1. Native Photoshop .psd (if graphics are built with layers, do not flatten), 300dpi, CMYK at 100% size.
  2. 300 dpi .tif, CMYK at 100% size.
  3. 300 dpi highest quality .jpg, CMYK at 100% size.
  4. Scalable vector .eps line art or native Illustrator or Freehand files.


Advertisements
www.bioedit.co.uk


EpiGenie.com


http://www.med.unc.edu/pmbb/symposium09.html

TRP Channels Madame Curie Bioscience Database