After various s.c. inoculation in nude mice, IIB-BR-G cells developed spontaneous metastases in the axillary LNs which were excised, cultured in vitro for a few passages and re-inoculated in nude mice s.c. After repeating this procedure for six times in order to enrich the population in metastatic cells, we generated IIB-BR-G-_MTS6 cell line (Fig. 1A). In vitro, both IIB-BR- and IIB-BR-G-_MTS6 cell lines grew as monolayers, although IIB-BR-G-_MTS6 cells tended to be less adhesive with a heterogeneous morphology and did not reach confluence as IIB-BR-G cells did. Their growth curves were also different since IIB-BR-G cells grew faster with a doubling time of 55.96 h while the growth of IIB-BR-G-_MTS6 cells was slower (doubling time 85.62 h) (Fig. 1B). However, anchorage-independent growth was significantly higher for IIB-BR-G-_MTS6 cells as compared with IIB-BR-G as evidenced in soft agar clonogenic assays (p < 0.0001) (Fig. 1C).

In vivo, IIB-BR-G-_MTS6 s.c. tumors grew earlier and faster with a calculated doubling time of 6.8 d compared with IIB-BR-G tumors (doubling time 8.7 d) (p < 0.0001) (Fig. 1D). Five weeks after inoculation IIB-BR-G-_MTS6 s.c. tumors have large central necrotic areas probably due to hypoxia generated by fast growth. The same phenomenon was observed but only after 19 weeks for IIB-BR-G cells (not shown).

IIB-BR-G and IIB-BR-G-_MTS6 cells inoculated s.c. in the back or in the mammary fat pad developed tumors in all recipients (n = 5) and IIB-BR-G-_MTS6 additionally developed metastases in axillary LN in 100% of mice by 5–6 weeks, while IIB-BR-G cells did not, even 19 weeks after inoculation (not shown). Metastases were evident macroscopically even in contralateral LN to the inoculated tumor. Metastasis to the LN was confirmed histologically after examination of hematoxylin-eosin stained sections (Fig. 1E–H). In some IIB-BR-G-_MTS6 bearing mice some micrometastasis to the lungs could also be found (not shown).

An antibody array using 174 antibodies distributed in three glass slides allowed us to test the relative expression of 168 different proteins secreted into CM and present in cell extracts of IIB-BR-G and IIB-BR-G-_MTS6 cell lines. This antibody array was selected to test the expression changes of cytokines, growth factors and chemokines that could be related to the metastatic ability of IIB-BR-G-_MTS6 cells relative to that of IIB-BR-G. All significantly deregulated proteins in IIB-BR-G-_MTS6 compared with IIB-BR-G cells are shown in Tables 1 and 2, corresponding to secreted proteins into CM and present in cell extracts, respectively. The relative expression values for all tested proteins that remained unchanged (log₂ relative expression IIB-BR-G-_MTS6/IIB-BR-G between 1 and -1) are shown in TableS1 and S2.

The analysis of CM showed that IIB-BR-G-_MTS6 secretion was higher for 37 proteins and lower for 27 while the other proteins remained unchanged. The most upregulated IIB-BR-G-_MTS6 secreted proteins (CM) were IL1β, IGFBP1, GROα/CXCL1, MIP-3α/CCL20, GM-CSF/CSF3, GCSF/CSF2, IL2R α, IL1α, IL6 and VEGFA. Among the less secreted proteins we found VEGFD, SDF1-β/ CXCL12, ICAM3, MMP13, AgRP, IL12 p40, FGF9, GITR-Ligand and MIP-1β/CCL4.

For some proteins signal in the antibody array was negative for both cells lines (less than two times negative controls signal), such as L-selectin (expressed in neutrophils), NGF (nerve growth factor), IL-2Rγ, IP-10/CXCL10, secreted by monocytes and lymphocytes, TECK/CCL25, (expressed in small intestine and thymus) and CK β 8–1. Also, in CM of both cell lines some receptors like EGFR, IL2RA, were detected presumably shed into the CM or derived from dead cells.

With respect to cell extracts, IIB-BR-G-_MTS6 showed upregulation of 24 proteins and downregulation of 6 compared with parental IIB-BR-G. The most upregulated proteins were MIP-1 α/CCL3, GCSF/CSF3, IL2Ra, CXCL1, PlGF and Adiponectin (APM1). Downregulation in IIB-BR-G-_MTS6 was found for Siglec5, TNFRSF21, IL2Rb and VEGFR2 (KDR). No expression of NGF, IL1 R4/ST2, IL1R1, IL1R2, IL11, L-Selectin, IP-10 or IL2 Rγ, was observed for both cell lines.

We used EASE annotation tool to disclose the potential biological relevance of the differentially expressed proteins that could be related to the metastatic phenotype we used. Using Gene Ontology Annotation we identified some functional categories that were over-represented among the IIB-BR-G-_MTS6 deregulated proteins recognized in the antibody array. Table 3 shows the combined CM and cell extracts results of the EASE analysis. It also revealed that expression of proteins located in chromosome 7 is significantly altered in IIB-BR-G-_MTS6 cells (p = 0.0069) since six of them located in 7p (EGFR, IGFBP1, IGFBP3, IL6, INHBA, PDGFA) and one in 7 q (HGF) have increased their expression in IIB-BR-G-_MTS6 as compared with IIB-BR-G cells.

To further investigate the biological relevance of genes that were up or downregulated in metastatic IIB-BR-G-_MTS6 relative to primary tumor-derived IIB-BR-G we queried PubMed manually. Based on the potential function of BC cancer cells and their relationship with metastasis, we collected those deregulated proteins in IIB-BR-G-_MTS6 cells that could be potentially associated to the metastatic ability and explored the previously published evidences. Grouped by their known role some of these proteins are briefly presented below along with results of additional experiments.

The oncogenic pathway EGFR-RAS signaling could have contributed to the autonomous cell proliferation in both cell lines as we have previously shown.¹⁵ Through the antibody array assay several growth factors were found upregulated in the IIB-BR-G-_MTS6 cells like CSF3, PlGF, CSF2, PDGF AA, PDGF AB, FGF2/bFGF, and the regulatory IGFBP1, 6, 4 and 3, as compared with non-metastatic IIB-BR-G. Some of these molecules could have a direct autocrine growth promoting effect but also could influence tumor stromal cells contributing to tumor growth. Also, IIB-BR-G-_MTS6 cell secrete significantly more IL4 to CM (4.26 log₂ fold change) than IIB-BR-G. Of note, despite its immune modulating activity IL4 has been shown to act as an autocrine survival factor in epithelial cancers.¹⁶ Thus, production of some growth factors in metastatic IIB-BR-G- _MTS6 cells could be a relevant change in protein expression relative to IIB-BR-G cells, facilitating cells growth that could serve to explain faster in vivo growth of IIB-BR-G-_MTS6 s.c. xenografts as compared with IIB-BR-G.

One critical event for tumor growth and metastasis is the generation of a new network of blood vessels that can be promoted by several cytokines produced by tumor or stroma cells. Several pro-angiogenic factors are upregulated in IIB-BR-G-_MTS6 cells and /or secreted into their CM compared with non-metastatic IIB-BR-G cell line: CXCL1, IL8, IL1β, IL1α, VEGFA, angiogenin/ANG, HGF, PlGF, LAP-TGFβ1 (latent TGFβ1), FGF2/bFGF and TEK (tie2, angiopoietin receptor) (Tables 1 and 2). In vitro IIB-BR-G-_MTS6 cells secreted much more vascular endothelial growth factor (VEGFA) to the CM but less VEGFD/FIGF. Both cell lines showed similar VEGFR3/FLT4 expression in cell extracts (Table S2) but VEGFR2/KDR, was downregulated in IIB-BR-G-_MTS6 cells (Table 2).

Since VEGFA is strongly upregulated in IIB-BR-G-_MTS6 cells in vitro, and its expression has been associated to higher LVD,¹⁷ we evaluated its expression in vivo by immunostaining of nude mice s.c. xenografts. As shown in Figure 2 both IIB-BR-G and IIB-BR-G-_MTS6 tumors showed blood vessels and microvessels stained with an anti-VEGFA/B mAb and also tumor cells showed membrane staining. Some of the VEGFA/B expressing cells seemed incipient structures that could reflect neoangiogenesis or vasculogenic mimicry. The positive staining area in IIB-BR-G-_MTS6 tumors was 2.99 times higher than in IIB-BR-G tumors (p = 0.044, t-test), evidencing higher VEGFA/B in vivo expression associated to the metastatic cells (not shown). Also, CD31 staining allowed us to evaluate the presence of blood vessels, microvessels and some positive cells without a definite structure distributed through the tumor (Fig. 2). CD31 positive areas were thus quantified instead of blood vessel counts to better reflect angiogenesis. In this case, CD31 positive areas were 1.89 times higher in IIB-BR-G-_MTS6 tumors compared with IIB-BR-G though in the limit of significance (p = 0.051, t-test).

It has been demonstrated that activation of lymphatic endothelium by VEGFC is crucial for tumor cell entry and migration via lymphatic vessels. Anti-VEGFC mAb was not included in the selected antibody-array that we used, thus we measured its expression by qRT-PCR in IIB-BR-G and IIB-BR-G-_MTS6 cell lines as well as in nude mice xenografts. As observed in Figure 3A both cell lines express VEGFC, however, higher expression in metastatic IIB-BR-G-_MTS6 tumors was found as compared with IIB-BR-G in vivo. As mentioned above, VEGFR3, the specific receptor for VEGFC was equally expressed by IIB-BR-G-_MTS6 and IIB-BR-G cells.

Next, we evaluated the lymphatic vessel density (LVD) in IIB-BR-G-_MTS6 and IIB-BR-G s.c. xenografts by immunostaining with anti-podoplanin, a specific marker of lymphatic endothelium. As observed in Figure 3B, no significant differences in LVD were found between IIB-BR-G-_MTS6 and IIB-BR-G tumors. In Figure 3C examples of podoplanin immunostaining for both s.c. tumors are shown. In IIB-BR-G-_MTS6, evaluation of LN metastasis with anti-podoplanin revealed many tumor cells located adjacent to lymphatic vessels and also emboli in the lumen of afferent lymph vessels evidencing lymphatic invasion (Fig. 1H). Our results suggest that increase of pro-angiogenic and lymphangiogenic factors expression has occurred in IIB-BR-G-_MTS6 cells after metastatic progression probably enabling tumor cells to generate more vascularized tumors and help facilitate tumor lymphatic invasion.

IIB-BR-G-_MTS6 cells exhibit higher expression of latency-associated peptide (LAP-TGFβ1) than IIB-BR-G, while other members of the TGFβ superfamily tested in the array, such as TGFβ1, TGFβ2, TGFβ3 and endoglin remained unchanged (Table 1 and Tables S1 and S2). TGFβ1 is synthesized as a large precursor molecule consisting of an N-terminal prodomain (LAP) and a C-terminal mature domain. LAP acts as a multifunctional peptide that extracellularly confers latency to TGFβ1.¹⁸ TGFβ has opposite roles in BC cancer progression either acting as a tumor suppressor in the initial phase, or stimulating invasion and metastasis at later stages. It is known that TGFβ-induced invasion is related to metalloproteinases MMP2 and MMP9 expression.¹⁹ Cell-associated MMP9 is upregulated in IIB-BR-G-_MTS6 cells as compared with IIB-BR-G (log₂ fold change 1.2, Table 2). We also validated MMP9 expression by zymogram using gelatin as a substrate and found that IIB-BR-G-_MTS6 expressed more active MMP9 than IIB-BR-G cells (Fig. 4A).

In an in vitro assay we tested both cellular migrations through 8µm pore filters and invasiveness using matrigel-coated filters. Although IIB-BR-G cells migrated more toward FBS (chemoatractant), IIB-BR-G-_MTS6 cells showed higher matrigel invasion (p < 0.05) (Fig. 4B and C). IIB-BR-G-_MTS6 cells showed more invasive ability in vitro which could be related to their higher expression of MMP9, MMP1, MMP13 and HGF that could facilitate matrigel degradation. Other upregulated molecule in IIB-BR-G-_MTS6 cells is PLAUR (urokinase type plasminogen activator receptor) (2.8 log₂ fold change) compared with IIB-BR-G. PLAUR is a key molecule for pericellular proteolysis in tumor cell invasion and metastasis.²⁰

Several of the IIB-BR-G-_MTS6 upregulated proteins correspond to gene products that are possible inducers of NFκB like GM-CSF, HGF, IL1 and also gene products regulated by NFκB like VEGF, IL6, IL8, MMP9 and MMP13. As a whole, this expression profile suggests a higher NFκB level of activation in IIB-BR-G-_MTS6 than in IIB-BR-G, which could be related to their metastatic ability. NF-κB is a crucial factor that is implicated in oncogenic pathways and also regulates immunoinflam-matory responses. High level of activation of NFκB has been reported in specific subtypes of BC, particularly those tumors that express erbB2 and are ER negative²¹ but tumors expressing EGFR (ErbB1) may also be equally dependent of competent NFκB.²²

In IIB-BR-G-_MTS6 metastatic cells combining cell-associated and secretion to CM results, the more upregulated cytokines/chemokines were IL1β, CXCL1, CCL3, CCL20, IL1α, IL6, CXCL8/IL8, IL4, CCL8, CXCL16, and the less expressed were CXCL12, CCL4, CCL19 compared with the parental IIB-BR-G cell line (Tables 1 and 2). Chavey et al. reported that multiple cytokines were overexpressed in ER negative BC and correlated with the inflammatory cell content and aggressiveness of the tumors.²³ IL1β is the most over-secreted cytokine in IIB-BR-G-_MTS6 CM vs IIB-BR-G and also IL1α is overexpressed. Of note, numerous in vitro and in vivo models have linked IL1β production to tumor cell migration, MMP9 and ICAM1 expression (both upregulated in IIB-BR-G-_MTS6 cells compared with IIB-BR-G), angiogenesis and activation of NFκB signaling pathway.²⁴ Interestingly, IIB-BR-G-_MTS6 cells CXCL12 (SDF-1) secretion is downregulated compared with IIB-BR-G non-metastatic cells. CXCL12 production has been associated to metastasis limitation by inhibiting CXCR4 signaling in melanoma, breast and colon cancer.²⁵

Of note, the basal like BC subtype-associated marker CX3CL1/fracktalkine is among the unchanged molecules expressed by both TNBC IIB-BR-G and IIB-BR-G-_MTS6 cells. Also, we have previously shown that high vimentin expression is found in both cell lines by immunocytochemistry.¹⁵ IIB-BR-G-_MTS6 cells express much more PlGF than IIB-BR-G cells (Table 2), a known vimentin stabilizer.²⁶ In light of these results we confirmed that both cell lines expressed intermediate filament vimentin as detected by western blot (Fig. 5A), but IIB-BR-G-_MTS6 presented higher expression. This higher vimentin expression in IIB-BR-G-_MTS6 cells was also confirmed by confocal microcopy (p < 0.05) (Fig. 5B) which also showed that both cell lines present highly organized actin F structures and that vimentin is mainly localized at cell extremes in IIB-BR-G-_MTS6 cells which displayed a spindle-like morphology (Fig. 5C). Moreover, with a 3D-topographical analysis and a plot-profile it was demonstrated that only IIB-BR-G-_MTS6 cells present vimentin surrounded by microfilaments at these extremes. This observation could be due to the reorganization of actin cytoskeleton as the cell becomes motile, and which has been reported for other cancer cells.²⁷ E-cadherin was not expressed in both cell lines as determined by immunocytochemistry (Fig. S3). Altogether these results suggest that IIB-BR-G-_MTS6 cells have undergone a pronounced epithelial-to-mesenchymal-transition (EMT) probably associated to their metastatic behavior.

We generated IIB-BR-G-_MTS6 cell line after s.c. inoculation of 1 × 10⁶ cells of IIB-BR-G-MT2 cell line,¹⁴ either in the mammary fat pad or in the back of 8 week old female mice N:NIH(S)-Fox1nu (Bioterio Universidad Nacional de La Plata, Argentina). After excision of LN metastasis, separation of tumor cells, amplification in few culture passages and s.c. re-inoculation in nude mice were performed. This procedure was repeated four times to enrich the tumor population with metastatic cells. In total, after six rounds of enrichment IIB-BR-G-_MTS6 cell line was obtained, amplified in culture to conform a stock and used for further experiments (Fig. 1A). Animals were maintained in a special facility in a ventilated Rack provided with HEPA filtered air in an Animal Facility at the Fundación Instituto Leloir-IIBBA (CONICET), in accordance with the guidelines of the NIH (Guide for the Care and Use of Laboratory Animals, 1996). The authors have received permission from the Institutional Animal Care and Use Committee for the nude mice experiments.

IIB-BR-G and IIB-BR-G-_MTS6 cell lines were grown as previously described.¹⁴ Cell growth curves were performed in quadruplicate by the MTT assay as previously described.⁶⁸ Anchorage independent growth ability was estimated in triplicate by the soft agar clonogenic assay as previously described. 5 × 10³ tumor cells were seeded and colonies were counted under an Olympus CKX41 microscope (Olympus) after 21 d culture.

IIB-BR-G and IIB-BR-G-_MTS6 cells (1 × 10⁶/0.1 ml phosphate buffered saline (PBS)) were injected s.c either in the mammary fat pad or the back of 8-week-old female nude mice. The tumors major and minor axes were measured with a caliper once a week. The tumor volumes were calculated using the formula: A²xB/2 where A = minor axis and B = major axis. Mice were euthanized with carbon monoxide; tumors were excised and samples were either formalin fixed or stored fresh at -80°C with RNAlater (Ambion) for RNA and protein extraction.

The expression of 168 proteins was tested simultaneously with a glass chips based Human Cytokine Antibody Array System G (RayBio Series G-2000 Series, slides VI, VII and VIII, AAH-CYT-G2000–8, RayBiotech) following the manufacturer’s protocol. Protein extracts and serum-free conditioned medium (CM) from either IIB-BR-G or IIB-BR-G-_MTS6 cell lines, were prepared following the manufacturer’s protocol. Cell pellets were extracted with lysis buffer for 30 min and protein concentration was estimated by Bradford’s method.⁶⁹ CM was collected after 24h culture of exponentially growing cells in serum-free culture medium. Briefly, after blocking the glass chips were incubated with cell extracts (100 µg total protein) or non-diluted CM (100 µl) overnight at 4°C. After washing steps chips were incubated with the corresponding biotin-conjugated antibodies for 2 h at room temperature (RT) and then washed four times. Finally, slides were incubated with fluorescent dye-conjugated streptavidin for 2h at RT in the dark and then washed. After complete drying the slides were scanned with an Axon Confocal Laser Scanner (GenePix 4000B, Axon Instruments) and images were processed with GenePix Pro 5.0 software.

Data were normalized to positive controls of each slide with the RayBiotech Analysis Tool (RayBiotech) and relativization was performed after local background correction and substraction for each of the three slides. Each protein was tested in duplicate and median signal values 2-fold above negative controls were considered positive. Fold-change in expression was calculated as log₂ of signal IIB-BR-G-_MTS6/signal IIB-BR-G. The threshold of significant difference in fold-change for each protein was considered as log₂ signal IIB-BR-G-_MTS6/signal IIB-BR-G > 1 or < -1, meaning that the protein is more than two times up or downregulated in IIB-BR-G-_MTS6 as compared with IIB-BR-G cells, respectively. Values between 1 and -1 were considered unchanged protein expression.

EASE software (DAVID, The Database for Annotation, Visualization and Integrated Discovery) was used to identify main gene categories differentially expressed by IIB-BR-G-_MTS6 cells in comparison with IIB-BR-G. Ease scores < 0.05 were considered significant. We also searched PubMed manually to investigate the biological relevance of genes that were up- and down- regulated.

Formalin-fixed, paraffin-embedded sections were prepared with IIB-BR-G and IIB-BR-G-_MTS6 cell pellets and/or tumor sections (4µm) and stained using the following primary mAbs: mouse anti-human VEGF (A and B) (a kind gift of Dr Alberto Baldi, IByME, Buenos Aires, Argentina), mouse anti-human E-cadherin (clone NCH-38, Dako), mouse anti-human CD31 (clone JC70, Cell Marque) (both evaluated with an irrelevant mouse IgG (Sigma) as a negative control) and hamster anti-mouse Podoplanin/gp36 (Abcam) (Hamster IgG as negative control). Immunostaining pretreatments consisted of sample dehydration in graded alcohols, enzyme digestion, or other heat mediated retrieval methods. Sections were stained using either Envision labeled polymer-HRP K4003 (Dako) or ABC system (Vectastain Universal Elite ABC kit, PK-6200, Vector Laboratories) and counterstained with hematoxylin.

Cells grown on poly-lysine-coated coverslips were fixed with 4% paraformaldehyde and permeabilized with 0.1% triton X-100 in PBS. Fluorescence microscopy was performed in a LSM10 Meta confocal microscope (Carl Zeiss). Image analysis for immune localizations was performed using the 3D-surface plot plug-in of the Image-J program (v.1.42) from the NIH. Signal quantification and cytoplasmic redistribution were analyzed as previously described.⁷⁰ The reagents used were monoclonal IgM anti-vimentin (ascites) from Sigma Chemical Co., phalloidin-labeled microfilaments from Molecular Probes and Hoechst (Sigma).

Samples were lysed with 50 mM TRIS-HCl (pH 7.5), 5 mM EDTA, 150 mM NaCl, 1% NP-40, 0.1% SDS, in presence of Protease Inhibitor Cocktail (Sigma) for 30 min on ice. Protein extracts were obtained after centrifugation at 8,000x g for 10 min at 4°C and total protein concentration was measured by the Bradford assay. Thirty micrograms protein extracts were loaded onto 10% SDS-PAGE gels. Proteins were transferred onto nitrocellulose membranes (Sigma), blocked with 3% dried skim milk in PBS and then incubated with anti-vimentin mAbs (Clone VI-01, Abcam) and an anti-Histone H3 mAb (clone A3S, Upstate) (Sigma) overnight at 4°C. Binding of the mAbs was revealed using Alkaline Phosphatase (AP)-conjugated goat F(ab)’₂ anti-mouse IgG(H⁺L) (Jackson Immunoresearch). Color development substrate was 5-bromo-4-chloro-3-indolyl-phosphate/nitro blue tetrazolium (NBT/BCIP) (Promega).

RT-PCR was performed with the isolated total RNA (1 μg). RT-PCR was performed with using 5 ng random primers and the cDNA was synthesized using 200 units of MMLV-Reverse Transcriptase (Promega) at 37°C for 60 min. Real time PCR analysis was performed using specific primers designed to target unique regions of the cDNA. PCR runs were performed using SYBR Universal Master Mix (Applied Biosystems), and relative expression levels were determined by the ΔΔCt method using β-actin gene expression to normalize all samples. Both melting curve analysis and gel electrophoresis assessment were used to confirm the specificity of PCR reactions. The following cycling parameters were used: denaturation 95°C (1 min), annealing 56°C (1 min), extension and detection 72°C (30 sec). The cycler software was used for quantification of VEGFC mRNA levels relative to β-actin mRNA expression. Primers for VEGFC: forward 5′CCTCAGCAAGACGTTATTTGAAATT3′ and reverse 5′TGGCAAAACTGATTGTTACTGGTT3′; for β-actin: forward 5′CCAGAGGCGTACAGGGATAG3′ and reverse 5′CCAACCGCGAGAAGATGA-3′.

In vitro migration and invasion assays were performed using 8 μm pore polycarbonate membrane transwells (BD Biosciences). For migration assay uncoated membranes were used while for invasion assay membranes were coated with 5μg/ml Matrigel (BD Biosciences). Cells were seeded in the upper chamber (5 × 10⁴ cells/well) in serum-free culture medium and incubated at 37°C for 4h. Culture medium plus 10% fetal bovine serum (FBS, Natocor) was used as chemoattractant. Following incubation, the medium was discarded from the upper chamber and the entire insert plate was removed for staining procedures. Membranes were fixed with cold methanol, stained with Giemsa and mounted onto glass slides with Canadax. Cells were counted under the microscope. Five 200 × fields/condition and three wells/condition were analyzed. Results are expressed as in Equation 1:

Condition media were obtained incubating 5 × 10⁵ cells of each cell line in 1.5 ml DMEM for 24hs. The media were then collected and stored at -80°C until assayed. To analyze the expression of metalloproteinases gelatin zymography was performed as previously described.⁷¹ Briefly, 15µl conditioned medium (CM) from IIB-BR-G and IIB-BR-G-_MTS6 cells were fractionated in 10% native PAGE containing 0.1% gelatin as substrate. After electrophoresis, gels were incubated for 1h at RT in Triton X-100 renaturing buffer and subsequently overnight at 37°C in developing buffer to allow enzymatic degradation of gelatin. The same assay was performed in the presence of 20 mM EDTA to inhibit the enzymatic reaction. After washing, the gels were stained with 0.125% Coomasie Brilliant Blue staining buffer and subsequently destained to visualize degradation bands. Molecular weight markers were used to determine the size of active enzymes. Pictures were documented with a trans-illuminator and a digital camera and the area of digestion was quantified using Image-J program (v.1.42) from the NIH software.

Sections were examined by optical microscopy (Olympus BX40) and pictures were captured with 400× magnification (Olympus Digital Camera DP72). To quantify VEGFA/B, CD31 and Podoplanin stainings at least 5 representative pictures from IIB-BR-G or IIB-BR-G-_MTS6 xenografts (n = 5) were analyzed using Fiji software. After setting the positive staining threshold, total positive areas were calculated for each picture.

To avoid duplications, the observation was made in a greek embroidery fashion. To separate immunostaining (brown stain) from hematoxylin staining (blue stain) the Color Threshold plug-in was applied. Images were then transformed into an 8-bit gray scale TIFF format. The number of stained structures was then counted. Data values obtained from at least 10 images of each slide were exported to a spreadsheet in order to perform the statistical analysis.

Comparisons between IIB-BR-G and IIB-BR-G-_MTS6 were analyzed using Student’s t-test to determine the p-values. p < 0.05 was considered significant.